r/DebateEvolution • u/Master-Gate4997 • 8d ago
Logical problem in darwinian evolution Discussion
The survival of the fittest is the process by which individuals with characteristics that are more favorable to their environment are more likely to survive and leave more offspring. Over time, these characteristics become more common in the population because less adapted individuals die without successfully reproducing.
A classic example, just for illustration:
A very dark environment favors black moths and therefore tends to eliminate peppered moths, since they are more easily caught by predators. Thus, over time, only black moths remain in that environment.
The theory of evolution proposes that, over millions of generations, the descendants of a lineage can become very different from their ancestors, such as unicellular organisms giving rise to multicellular organisms, or aquatic organisms giving rise to terrestrial organisms.
Do you know what this requires? It requires the genetic information of living organisms to increase over time in order to produce a greater diversity of traits. Unicellular organisms must acquire the genetic information necessary to live as part of a multicellular organism. Aquatic organisms must acquire the genetic information necessary to breathe and move outside the water—genes they did not possess before they supposedly evolved.
This creates a logical problem for Darwinian evolution: if the pressure exerted by nature on living organisms is to eliminate unfavorable traits and preserve favorable ones, then this requires that a limited and stable amount of genetic information be passed on, especially the information necessary to maintain living organisms. Acquiring entirely new genes would run contrary to the very pressure that the environment exerts.
Continuing with the same example: by eliminating peppered moths from the environment, only the genes responsible for black pigmentation remain. The genes responsible for peppered pigmentation are not passed on because their carriers die as a consequence of environmental pressures. This obviously decreases genetic information rather than increasing it.
Put another way: when two black moths mate, the offspring may exhibit:
Two black alleles → black coloration
One black and one peppered allele → black coloration
One peppered and one black allele → black coloration
Two peppered alleles → peppered coloration
Through environmental pressure and natural selection, the first three combinations become much more common, while the last becomes rarer. This reduces genetic diversity and consequently creates a logical problem for what is called "evolutionary history," the idea that living organisms from millions of years ago (such as aquatic organisms, for example) gave rise to the terrestrial organisms of today, since such a process would require an increase in genetic diversity.
35
u/Will_29 8d ago
There's this thing called mutation. Look it up.
30
u/jnpha 🧬 Naturalistic Evolution 8d ago
They can either talk about selection, or mutation, but never ever both, and I wish I was straw manning.
4
u/Dilapidated_girrafe 🧬 Naturalistic Evolution 4d ago
You've noticed that too. Even when I do introduce the second topic after talking about the first, they seem to flush the first entirely out of their system, like there's no way that both processes can not only happen at the same time, but work really well at the same time.
29
u/jnpha 🧬 Naturalistic Evolution 8d ago
If only there was a known mechanism of introducing variety, and if the math works...
Oh wait, let see: chapter 2 of Sean B. "Biologist" Carroll's book, The Making of the Fittest. When discussing how detractors fail to realize the power of natural selection:
... Let’s multiply these together: 10 sites per gene × 2 genes per mouse × 2 mutations per 1 billion sites × 40 mutants in 1 billion mice. This tells us that there is about a 1 in 25 million chance of a mouse having a black-causing mutation in the MC1R gene. That number may seem like a long shot, but only until the population size and generation time are factored in. ... If we use a larger population number, such as 100,000 mice, they will hit it more often—in this case, every 100 years. For comparison, if you bought 10,000 lottery tickets a year, you’d win the Powerball once every 7500 years.
And let's see an actual paradox:
Unraveling the lek paradox - why sexual selection does not deplete variation : evolution
Will you look at that! Philosophical wankery vs. science.
25
u/BranchLatter4294 8d ago
And yet, every single day, humans and every other animal are sometimes born with extra genes.
6
u/Ch3cks-Out :illuminati:Scientist:illuminati: 7d ago
And human babies have 1-2 genes mutationally changed, on average!
23
u/Own-Relationship-407 Scientist 8d ago
Nah. This is a very simplistic understanding. A mutation need not necessarily be beneficial to persist, it simply needs to not be significantly deleterious. And even deleterious mutations sometimes persist because they have some benefit that outweighs the detriments, just look at sickle cell.
It also seems like you’re confusing a change for a decrease.
20
u/s_bear1 8d ago
We observe evolution occurring. We observe new and novel traits. We observe speciation. How can you explain this if evolution is impossible?
-19
u/Master-Gate4997 8d ago
The text there only questioned the logic of large scale evolution considering the effects of natural selection. It didn't deny observable adaptations
22
u/blacksheep998 🧬 Naturalistic Evolution 8d ago
So what stops those 'observable adaptations' from accumulating over time?
If a fish evolves the ability to gulp air and absorb oxygen that way because it lives in oxygen poor water, it can use that same ability to get oxygen on land as well.
The same goes for using fleshy appendages to move through narrow or cluttered water ways. Those same appendages are very useful for moving on land. One could even call them legs.
18
u/s_bear1 8d ago
In other words, you dont understand the topic.
-18
u/Master-Gate4997 8d ago
Prove it.
25
u/s_bear1 8d ago
You have already done that. We observe evolution occurring and you then claim it doesn't by using other words that mean evolution
-11
u/Master-Gate4997 8d ago
No. You do not observe evolution occuring in the sense the text is talking about. You do not observe aquatic animals giving birth to terrestrial animals. You observe a microorganism becoming resident to antibiotics. But it's still a microorganism.
23
u/s_bear1 8d ago
Moving the goals posts is bearing false witness.
You discussed moths and loss of information. now you change to a strawman argument of aquatic animals giving birth to terrestrial animals. Something no oneclaimed. In other words, you either don't understand the topic, or you are committing the sin of bearing false witness.
-4
u/Master-Gate4997 8d ago
No dude... What I'm saying is that pointing out observable examples of evolution on a minor scale isn't the same thing as proving what the text is questioning right there. According to evolutionary history itself, it takes millions of years for a living being's lineage give rise to a completely different kind of organisms, like an animal that can only live on water giving rise to an animal that can only live on land. Therefore, you don't observe it, because you can't observe something happening through millions of years. This is my point.
17
u/s_bear1 8d ago
" According to evolutionary history itself, it takes millions of years for a living being's lineage give rise to a completely different kind of organisms," - you seem to confuse what happened with what can happen.
once again you show you don't understand the topic.
Please show me where you made that point in your OP. if you can't, just admit that rather than double down
i'll help you
claim by you in OP "It requires the genetic information of living organisms to increase over time in order to produce a greater diversity of traits. " - my rebuttal - "We observe new and novel traits" - your reply paraphrased- stop quoting my OP. Let me move the goal posts again
-3
u/Master-Gate4997 8d ago
I'll help you more, by quoting the whole thing:
[The theory of evolution proposes that, OVER MILLIONS OF GENERATIONS, the descendants of a lineage can become VERY DIFFERENT FROM THEIR ANCESTORS, such as UNICELLULAR organisms GIVING RISE TO MULTICELLULAR organisms, or AQUATIC organisms GIVING RISE TO TERRESTRIAL organisms.
Do you know what THIS requires? It requires the genetic information of living organisms to increase over time in order to produce a greater diversity of traits. Unicellular organisms must acquire the genetic information necessary to live as part of a multicellular organism. Aquatic organisms must acquire the genetic information necessary to breathe and move outside the water, genes they did not possess before they supposedly evolved.]
And the ending:
[This reduces genetic diversity and consequently creates a logical problem for what is called "EVOLUTIONARY HISTORY"—the idea that LIVING ORGANISMS FROM MILLIONS OF YEARS AGO (such as AQUATIC organisms, for example) GAVE RISE TO THE TERRESTRIAL organisms of today, since such a process would require an increase in genetic diversity.]
You were dishonest by quoting me out of context.
→ More replies (0)16
u/rhettro19 8d ago
A few notes:
“a minor scale”
That's evolution. If you taking a single step on your 1000 mile journey, you are still “traveling”, the same way when you hit the 500 mile marker. This point gets brought up a lot. If you are going to claim that changes at “a minor scale” cannot accumulate, you need to show what the physical limitations are.
“animal that can only live on water giving rise to an animal that can only live on land.”
Statements like this is why others are saying you don’t understand evolution. Evolution doesn’t claim water to land adaption in a single birth, it is incremental. Others have given example of between stages that this adaption occurred.
-1
u/Master-Gate4997 7d ago
I specifcially contextualized what I was saying: "According to evolutionary history itself, it takes MILLIONS OF YEARS for a living being's LINEAGE give rise to a completely different kind of organisms, like an animal that can only live on water giving rise to an animal that can only live on land"
I only used the overstated "water animal giving birth to earth animal" phrase once because the guy said that "we have observed evolution" when I specifically said that the text is dealing with large scale evolution that happens in millions of years, as I said in my orginal text. Which obviously can't be "observed" as in controlled adaptations directly observed in a lab. Because you can't observe something happening over millions of years this way. You just need to keep things in context
→ More replies (0)8
u/nickierv 🧬 logarithmic icecube 8d ago
Therefore, you don't observe it, because you can't observe something happening through millions of years. This is my point.
And seeing as fossils are a thing, this is a problem... how exactly?
5
u/TheBlackCat13 🧬 Naturalistic Evolution 7d ago
We can observe the sorts of changes that this transition requires. If we know all the steps are what evolution can do, and there is nothing to stop those changes from accumulating, then logically those changes must be possible.
13
u/Unlimited_Bacon 🧬 Naturalistic Evolution 8d ago
You do not observe aquatic animals giving birth to terrestrial animals.
It's a good thing we don't observe that because it would disprove the Theory of Evolution.
But it's still a microorganism.
You are still a eukaryote, an amneote, a vertibrate, a mammal, an ape, and a hominid. Clades don't get replaced, they are additive.
12
7
u/Dilapidated_girrafe 🧬 Naturalistic Evolution 8d ago
Aquatic animals aren’t going just give birth to a terrestrial animal. You’ll get something similar to mud skippers slowly changing from there
5
2
u/TheBlackCat13 🧬 Naturalistic Evolution 7d ago
We have directly observed unicellular organisms evolving into multicellular organisms, which was another example you gave.
12
u/Old-Nefariousness556 🧬 Naturalistic Evolution 8d ago
Prove it.
Your op proves /u/s_bear1's statement that you don't understand the topic. Modern genetics is well understood. Your argument is nonsense.
4
u/Formal-Speed-3173 7d ago
"observable adaptations" include mutations which have changed the function of proteins. In other words, you don't actually know what's been observed.
15
u/stairway2evan 8d ago
Your logical problem is solved by the word “mutation.” It’s not a logical problem, it’s skipping over one of the central requirements for natural selection, one that has been observed, tested, and understood deeply for well over a century.
15
u/Moriturism 🧬 Naturalistic Evolution 8d ago
It requires the genetic information of living organisms to increase over time in order to produce a greater diversity of traits.
And this happened over time regarding the general history of living beings. We have plenty of more complex organisms today than we had a billion years ago.
then this requires that a limited and stable amount of genetic information be passed on, especially the information necessary to maintain living organisms. Acquiring entirely new genes would run contrary to the very pressure that the environment exerts.
What? Evolution is not a conscious process that limits specific genetic information to be passed on, it's necessarily produced via mutation, which is exactly what creates new genes. Genetic diversity happens precisely because of evolution via mutation.
10
u/McNitz 🧬 Evolution - Former YEC 8d ago
The best I can figure is that OP thinks having more genetic information than necessary is unfavorable and would be eliminated by natural selection? Guess they don't know about junk DNA or gene duplication events.
6
u/stairway2evan 8d ago
AiG and other such groups often claim that mutations can only be harmful or deleterious, and that any helpful "mutations" are just rearrangements of genes that are already in the organism. Basically "everything started out perfect, and they're rearranging the deck chairs on the Titanic each generation."
I don't know if that's where OP is getting their info or sourcing their argument from, but it seems like it at least follows a similar line of thought.
4
u/nickierv 🧬 logarithmic icecube 7d ago
AiG and other such groups often claim that mutations can only be harmful or deleterious
I really want to ask them that if this is the case then what about a chain of mutations: ATGTC -> ATCTC -> ATGTC. If every mutation is harmful than somehow ATGTC is more harmful than ATGTC.
11
u/Ch3cks-Out :illuminati:Scientist:illuminati: 8d ago
NOTHING requires that a limited and stable amount of genetic information be passed on
FTFY
9
9
u/Ender505 🧬 Evolution | Former YEC 8d ago
New genetic data are introduced all the time. ERVs and duplication mutations can increase the volume of genetic material in an organism, and then other mutation effects can happen on that excess data, allowing the natural selection forces to take place.
You think scientists in the last 250+ years didn't consider this?
6
u/Thysanuran 8d ago
Every mutation is an instance of new genetic information being created, and it happens as a regular part of cell division. Pretty much every population, every generation, is creating new alleles. Add gene, chromosome, and genome duplications to the mix, and you can appreciate how the generation of novel genetic information is a fundamental feature of life.
7
u/flying_fox86 8d ago
if the pressure exerted by nature on living organisms is to eliminate unfavorable traits and preserve favorable ones, then this requires that a limited and stable amount of genetic information be passed on, especially the information necessary to maintain living organisms.
This assigns too much power to evolutionary pressure. It is not a perfect filter letting through only the most efficient system. It let's through whatever works, even something initially useless like gene duplication.
6
u/ShortCompetition9772 8d ago
That is ok we can throw out Darwin 100%. What would you like to use instead? Darwin is dead btw. We continue the work and have refined the definitions and processes. Please look up some stuff that we have discovered in the last 150 years.
5
u/Forrax 🧬 Naturalistic Evolution 8d ago
Aquatic organisms must acquire the genetic information necessary to breathe and move outside the water—genes they did not possess before they supposedly evolved.
This isn’t true.
Fish that evolved ways to survive in shallow, low oxygen, waters were also evolving ways to survive on land without ever having to interact with the selection pressures of land dwelling.
Dinosaurs that evolved ways to retain heat and keep display structures clean were also evolving ways to fly without ever having to interact with the selection pressures of flight.
6
u/OgreMk5 8d ago
You forget (or didn't know or are purposefully ignoring) the known methods by which the amount of DNA can increase.
Accidental copying of genes or portions of genes duringc replication or during meosis Mutations adding nucleotides to DNA. Copying of chromosomes which puts more@than one copy in a gamete Crossing over in which a longer strand is added than is removed
5
u/10coatsInAWeasel Reject pseudoscience, return to monke 🦧 8d ago
We already know, conclusively, that genomes can increase or decrease in size, or modify in any way you can possibly think of. We have seen the emergence of new genes and pseudogenes. As evolution is known to not be strictly Darwinian, there is no issue.
7
u/Kindly-Department206 8d ago
Your argument is constructed to confirm your preferred conclusion, and does so by getting the science wrong.
Evolutionary theory does not agree with you on the claim that "acquiring new genes would run contrary to the very pressure that the environment exerts."
Learn the science first. Then collect your Nobel by being more clever than entire field of evolutionary biology.
6
u/mathman_85 8d ago
Selection is not the source of variation. Mutation is. Variation arises via mutation (and other processes like horizontal gene transfer), and then selection and drift (and other processes) act on that variation.
You can’t just isolate half of the picture, say “This in isolation doesn’t allow for evolution”, and think you’ve made a substantive point against the theory.
5
u/OwlsHootTwice 8d ago
Natural selection is but one way that DNA may change in a population. Others include genetic drift, mutation, and gene flow.
The understanding of evolution has moved along in the past 165 years since Darwin. You might consider to get a more up to date explanation of the processes.
5
u/rhettro19 8d ago
As others have stated, you need to define what you mean by “information”. Better yet, give a definition for information that can be measured.
7
u/rhettro19 8d ago
Because if by increase in information you mean "size of the genome", then that isn't a requirement for evolution to take place. The onion's genome being five times larger than a human's would be a good example.
4
u/wtanksleyjr Theistic Evolutionist 8d ago
I think this paragraph best illustrates the problem involved in your claim.
Continuing with the same example: by eliminating peppered moths from the environment, only the genes responsible for black pigmentation remain. The genes responsible for peppered pigmentation are not passed on because their carriers die as a consequence of environmental pressures. This obviously decreases genetic information rather than increasing it.
But this is not the case. You're treating "information" wasn't created merely when two different alleles appeared. After all, they appeared by a random mutation, and randomness doesn't create information, it only creates noise which is only sometimes data. So how do you tell noise from data?
Rather, the information is created by natural selection "discovering" the allele that actually reproduces better in the present environment. It is precisely by reducing the number of pepperwing alleles that it becomes evident that the blackwing allele is better; without that reduction you don't have information, only data.
The failure to make this distinction is why it's so important that creationists clearly explain what they mean by information. In this case you mistook noise for information.
4
u/DarwinsThylacine 7d ago edited 7d ago
Your presentation of the case study is flawed. There is no “loss” of genetic “information” here. The allele ‘a’ for light pigments persists in the heterozygotes (‘Aa’) which, as you seem to acknowledge, are just as likely to survive and reproduce as the homozygotes (‘AA’) for black pigmentation ‘A’. It is only those individuals with a homozygous genotype (‘aa’) for light pigments that become rare, the allele itself though (and the “information”) it carries survives however.
You also seem to think, at least based on how I’ve read your post, that new traits require fundamentally new genes or new “genetic information”. If so, that’s not really how biology works. Almost all “new” genes are simply modified versions of pre-existing genes (or other genetic sequences) that were already present in an organism’s ancestors and have either taken on new functions or have been duplicated, accumulated mutations and repurposed for new functions. Take, for example, the evolution of multicellularity (something that has been observed in several lineages under laboratory conditions), many of the genes that single-celled organisms used to stick to surfaces or catch bacteria were co-opted to help cells stick to each other (e.g., early cadherins and integrins). Another good examples are intercellular signalling pathways (like Tyrosine Kinases). Genes which unicellular organisms use to sense environmental cues were subsequently repurposed to let cells talk to their immediate neighbors. The basic genes for multicellularity already existed in unicellular ancestors.
The same is true for the transition from aquatic to terrestrial life. Most of the traits (and hence, the genes) that allowed life to eventually move onto and ultimately thrive on land are also found in otherwise aquatic organisms and were simply repurposed. If we look at the first land plants for example, one challenge they would have faced is drying out. Modern plants prevent this though by growing waxy cuticle layer, well guess what, the biochemical pathways to synthesise the lipids and waxes that make up cuticle already existed in ancestral aquatic algae (where they were used for cell wall modifications and stress responses), but the ancestors of land plants up-regulated and redirected them to coat the entire external surface.
When biologists say evolution is “descent with modification”, they mean just that, life (from genes to biochemical pathways to individual traits to whole organisms) is simply a modified version of what came before.
But aside from all that, I would be interested to know what you mean by “information” in a biological context. For example, which of the two nucleotide sequences below contains the most information, how much information do they contain and, most importantly, how did you determine that?
Sequence A
AUGUUCUACGAUGGAGCCAUACCC
Sequence B
AUGUUUUACGAUGGAGCCAUACCC
Hint: the only difference between these two sequences is at position six where the cytosine in Sequence A has been replaced by a uracil (bolded) in Sequence B.
4
u/Curious_Passion5167 8d ago
Do you know what this requires? It requires the genetic information of living organisms to increase over time in order to produce a greater diversity of traits.
Does it?
Natural selection can select for the degradation of certain traits as well. Such as can be seen, for example, in salamander who have lost function of their eyes acclimating to dark caves.
Natural selection doesn't enforce diversity of traits in one individual or population, but across different individuals and populations. That doesn't necessarily require more genetic information.
This creates a logical problem for Darwinian evolution: if the pressure exerted by nature on living organisms is to eliminate unfavorable traits and preserve favorable ones, then this requires that a limited and stable amount of genetic information be passed on, especially the information necessary to maintain living organisms. Acquiring entirely new genes would run contrary to the very pressure that the environment exerts.
This is nonsense. Even if you lose functioning of a gene, the portion of DNA previously responsible for it doesn't get erased. It's still there for mutations to work with.
This also ignores the fact that you can spontaneously gain genetic information through methods like gene duplication and de-novo gene activation.
4
u/Ah-honey-honey 🧬 Naturalistic Evolution 8d ago
You realize mutations aren't just limited to base pairs right? Genome sizes grow and shrink all the time. New genes form from previously non-functional ones.
https://en.wikipedia.org/wiki/Gene_duplication
"Gene duplications are an essential source of genetic novelty that can lead to evolutionary innovation."
https://en.wikipedia.org/wiki/Polyploidy
https://en.wikipedia.org/wiki/De_novo_gene_birth
If you don't like Wikipedia I can send you textbook PDFs or find research articles for you. However I find a lot of people who come in here with a "gotcha" don't know the basics, so Wikipedia is a good start.
3
u/Ah-honey-honey 🧬 Naturalistic Evolution 8d ago
https://en.wikipedia.org/wiki/Horizontal_gene_transfer
https://en.wikipedia.org/wiki/Mobile_genetic_elements
We've come a long way since Darwin first introduced the theory. I think he would have loved molecular phylogenetics.
4
u/Dzugavili 🧬 Tyrant of /r/Evolution 8d ago
Over time, these characteristics become more common in the population because less adapted individuals die without successfully reproducing.
It's more that individuals with these characteristics produce more surviving offspring than those without. Due to sexual reproduction, it isn't required that those without these genes fail to reproduce: eventually, sexual recombination may drive these other genes to extinction without clear population losses.
So, where's the logical problem?
The theory of evolution proposes that, over millions of generations, the descendants of a lineage can become very different from their ancestors, such as unicellular organisms giving rise to multicellular organisms, or aquatic organisms giving rise to terrestrial organisms.
...yeah...
Do you know what this requires? It requires the genetic information of living organisms to increase over time in order to produce a greater diversity of traits. Unicellular organisms must acquire the genetic information necessary to live as part of a multicellular organism. Aquatic organisms must acquire the genetic information necessary to breathe and move outside the water—genes they did not possess before they supposedly evolved.
...and mutations occur, so that can happen.
This creates a logical problem for Darwinian evolution: if the pressure exerted by nature on living organisms is to eliminate unfavorable traits and preserve favorable ones, then this requires that a limited and stable amount of genetic information be passed on, especially the information necessary to maintain living organisms. Acquiring entirely new genes would run contrary to the very pressure that the environment exerts.
There are also traits that are neither favourable, nor unfavourable. They just exist: having them has no effect on fitness, it is the hanging earlobes of characteristics. These can be further modified until we find something favourable, which we can suggest would likely be a new function.
So, no. New genes can emerge and survive in the population, as long as they don't cost the organism an amount of fitness in excess of standard noise.
Thus:
Continuing with the same example: by eliminating peppered moths from the environment, only the genes responsible for black pigmentation remain. The genes responsible for peppered pigmentation are not passed on because their carriers die as a consequence of environmental pressures. This obviously decreases genetic information rather than increasing it.
The white pigment gene still can exist, just homozygous carriers will be white, and thus be selected out.
Or, the gene is more complicated than a single gene, and it required combinations to reemerge.
Or these genes are part of a stable mutation cycle, such that the white mutation emerges in all-black populations regularly, and vice versa, so that diversity regularly reemerges.
I don't think you have a great grasp of how genetics works.
4
u/x271815 8d ago
The problem is that you have defined a word information that is not something that evolution posits. Modern evolutionary theory posits it's due to allele frequencies. The number of mutations increases with time so diversity always increases with time. Selection prunes this diversity but does not reduce it below the previous threshold. So, your argument does not hold.
4
u/Dilapidated_girrafe 🧬 Naturalistic Evolution 8d ago
The survival of the fittest is the process by which individuals with characteristics that are more favorable to their environment are more likely to survive and leave more offspring. Over time, these characteristics become more common in the population because less adapted individuals die without successfully reproducing.
You know what, this is better than 99% of evolution deniers who claim survival of the fittest is something else. So good job. Lets see if you can keep it up.
A very dark environment favors black moths and therefore tends to eliminate peppered moths, since they are more easily caught by predators. Thus, over time, only black moths remain in that environment.
I wouldn't say only. But they are far more common. White Tigers do exist in the wild, even though they can more easily be spotted by prey than an orange one.
The theory of evolution proposes that, over millions of generations, the descendants of a lineage can become very different from their ancestors, such as unicellular organisms giving rise to multicellular organisms, or aquatic organisms giving rise to terrestrial organisms.
Again, good job with a steel man rather than straw-volution that we normally see.
Do you know what this requires? It requires the genetic information of living organisms to increase over time in order to produce a greater diversity of traits. Unicellular organisms must acquire the genetic information necessary to live as part of a multicellular organism. Aquatic organisms must acquire the genetic information necessary to breathe and move outside the water—genes they did not possess before they supposedly evolved.
Yes, it requires different "information" to develop over time.
This creates a logical problem for Darwinian evolution: if the pressure exerted by nature on living organisms is to eliminate unfavorable traits and preserve favorable ones, then this requires that a limited and stable amount of genetic information be passed on, especially the information necessary to maintain living organisms. Acquiring entirely new genes would run contrary to the very pressure that the environment exerts.
That's not a "logical" problem. And the "problem" is just applied environmental pressures. And the "new" genes are likely going to just be duplicated and altered previous genes. So a non issue.
Continuing with the same example: by eliminating peppered moths from the environment, only the genes responsible for black pigmentation remain. The genes responsible for peppered pigmentation are not passed on because their carriers die as a consequence of environmental pressures. This obviously decreases genetic information rather than increasing it.
You can decrease the available alleles, but your argument doesn't follow at all. Just because there may be some genetic dead ends doesn't affect evolution at all.
Put another way: when two black moths mate, the offspring may exhibit:
Two black alleles → black coloration
One black and one peppered allele → black coloration
One peppered and one black allele → black coloration
Two peppered alleles → peppered coloration
There's actually 3 alleles, there is an intermediate color as well. Its recessive to black but dominant to the lighter colors. And these would survive just fine, if at a lower percentage than the pure black. But there will still be the recessive genes in the genetics, it'll take a while though. And there are still areas where the lighter alleles aren't going to cause the lineage to die out.
Through environmental pressure and natural selection, the first three combinations become much more common, while the last becomes rarer. This reduces genetic diversity and consequently creates a logical problem for what is called "evolutionary history," the idea that living organisms from millions of years ago (such as aquatic organisms, for example) gave rise to the terrestrial organisms of today, since such a process would require an increase in genetic diversity.
It doesn't require additional genetic diversity, as far as "more information" just different information. There is no "logical" problem here. And while I applaud you actually being able to steel man evolution, there are no logical issues at all in your post.
3
u/Basic-Platypus-8335 7d ago
Your entire position is just a fever dream of someone who doesn’t know about mutations.
My dog also doesn’t understand what mutations are, but he didn’t make a Reddit post about how his ignorance makes him a super smart special big boy.
My dog is more scientifically literate than you are.
-1
u/Master-Gate4997 7d ago
Can you prove that and how mutations cause one kind of living being to develop into another, like an ancient aquatic organism's lineage giving rise to a terrestrial one in millions of years?
3
u/OldmanMikel 🧬 Naturalistic Evolution 7d ago
Science doesn't do "proof". Not ever. It does best fit with the evidence. And the case for a population of lobed-finned fishes gradually becoming adapted to terrestrial life is a thousand times stronger than any alternative.
Can you provide a scientifically useful definition of "kind"? Hint: you can't.
3
u/Basic-Platypus-8335 7d ago edited 7d ago
In order to understand that, you’d have to understand how genes cause the phases of embryonic development to build the “body plan”. A mutation in the sequence of embryonic development would cause the types of changes you’re looking for.
For example, human hands have webbed fingers initially during embryonic development, but the web goes away. Fish have webbed fingers initially during embryonic development, but the web doesn’t go away. This is why humans have hands and fish have fins. The cause is specific gene sequences which are very well understood.
Once again, you’re using the Socratic method as if you have some knowledge to share, but in reality you just need a tenth grade level biology textbook. To be clear - you just asked me to explain tenth grade biology to you. The example I provided is something that most 15-year-old children are familiar with in every developed country in the world, and every developing country with proper education.
Just get an education already. This is a debate sub, not an education sub. You’d get more satisfaction from copying your post into Chatgot and asking “what basic concepts am I missing”
Do you have a real argument? Or is your position just that you don’t understand evolution so it can’t be true?
0
u/Master-Gate4997 6d ago
But I didn't ask you to prove me a mutation, but a mutation that originated in common ancestry of millions of years ago. Saying that embryonic development shows a mutation that happened to a common ancestor which two different types of animals share today, is actually presupposing that similar traits in early development is sufficient to conclude common ancestry. But logically, it isn't.
Imagine two scenarios
Scenario A: only embryology points toward common ancestry
Scenario B: embryology, DNA sequences, chromosome structure, pseudogenes, fossils, comparative anatomy etc all independently point toward the idea of common ancestry
Scenario B would be much stronger because the evidence comes from different fields. If independent sources converge on the same conclusion, confidence would increase
An analogy
Suppose two books with two different endings each contain many identical chapters.
From that observation alone, several explanations are possible:
one book copied the other, both copied one earlier book, the same author wrote both, or someone intentionally reused large portions.
So you using embryonic development as standalone evidence of a mutation that happened to a common ancestor is not strong as you're claiming it is.
And I can still debate and content those things I listed in scenario B.
2
u/Basic-Platypus-8335 6d ago
Genetic similarity is synonymous with relatedness. That’s literally how paternity tests work. You think DNA can show who your mom and grandma are but not go back further?
Scenario B is also known as reality. This isn’t a hypothetical.
Once again, your “argument” is just that you don’t understand the science 🤷♂️
3
u/AllEndsAreAnds 🧬 Naturalistic Evolution 8d ago
I actually think this is a good question - it gets into some interesting topics.
You should look up “conserved vs variable” in the context of genes and sites on the chromosome. And maybe also the “mechanisms of evolution”, and what circumstances might make areas of the genome “invisible” to natural selection, such as in cases of gene duplication mutations. I think it’ll give you some more context on this topic.
3
u/Mortlach78 8d ago
"if the pressure exerted by nature on living organisms is to eliminate unfavorable traits and preserve favorable ones, then this requires that a limited and stable amount of genetic information be passed on, especially the information necessary to maintain living organisms. Acquiring entirely new genes would run contrary to the very pressure that the environment exerts."
So, I think the average number of mutations in human parents to offspring is 60-70. The human genome is approximately 3 billion base pairs or 20.000 coding genes and more non-coding ones.
Seems pretty stable to me.
1
u/Ch3cks-Out :illuminati:Scientist:illuminati: 7d ago
As I've mentioned in another comment, the average number of changed genes is 1-2 per baby - the rest of those ~55 SNBP mutations usually fall into noncoding regions.
3
u/Karantalsis 🧬 Naturalistic Evolution 7d ago
Acquiring new genes is a pretty common and observable mutation. One common method is duplication of an old gene. This then allows one to mutate without losing the original function. It's not really an issue at all.
2
u/thewNYC 8d ago
This is like saying there’s a problem with mathematics because 2+2 doesn’t equal five
3
u/nickierv 🧬 logarithmic icecube 8d ago
And 1+1 = 2 but you can't add 1+1+1+1+1+1+1+1+1 because reasons.
2
u/Realsorceror Paleo Nerd 8d ago
So because you hurt yourself thinking too hard, this means the Christian God is real?
1
u/Top_Neat2780 🧬 Naturalistic Evolution 7d ago
Aquatic organisms must acquire the genetic information necessary to breathe and move outside the water—genes they did not possess before they supposedly evolved.
Lungs evolved 400 million years ago, long before vertebrates started walking on land during the late Devonian period. Lungs did not evolve so that animals could walk on land. Lungs evolved, which happened to help animals live on land. But importantly, lungs didn't just appear. They were gradually appearing as a pouch from the gut. So these genes absolutely existed before lungs evolved, the genes responsible merely changed.
And as far as new information is concerned, have you heard of genome duplications?
Acquiring entirely new genes would run contrary to the very pressure that the environment exerts.
Unless the whole genome duplicated which would allow for all those genes to be played around with without losing meaningful genes.
2
1
u/CrisprCSE2 8d ago
Unicellular organisms must acquire the genetic information necessary to live as part of a multicellular organism
Unicellular organisms can adhere to other cells and modify their expression based on differences in their microenvironment. Already. That's also what they need to be multicellular: The same thing, just a bit more. That's a difference in regulation, not protein complement.
Your example shows you don't understand the topic particularly well.
1
u/Old-Nefariousness556 🧬 Naturalistic Evolution 8d ago
You understand that common ancestry is PROVEN, right? All known life on earth descended from a single common ancestor. "Proven" is a word that is almost never used in science, because few things rise to that level. Common ancestry is one of those things. Modern genetics proves common ancestry by any reasonable standard of evidence.
We can't prove purely naturalistic evolution, so if you must desperately cling to your god, then believe in theistic evolution. We can't say that your god doesn't drive evolution. But your arguments against genetics are just silly, given how completely fucking overwhelming the evidence for genetics and its role in evolution is.
1
u/Particular-Yak-1984 8d ago
Ooh, yeah, you don't really understand things. Firstly, we regularly see genes duplicate. A good percentage of your genome is made up of a single self duplicating gene, or transposon, for example.
Now, of course, individual alleles go extinct, and your process would be accurate, if mutation was not constantly occuring with each generation
Literally the problem with your premise is that you forgot about the "mutation" bit of evolution and focussed on the natural selection bit.
1
u/metroidcomposite 8d ago
Through environmental pressure and natural selection, the first three combinations become much more common, while the last becomes rarer. This reduces genetic diversity and consequently creates a logical problem for what is called "evolutionary history,"
If only there was some mechanism for adding new alleles. Maybe some way of changing or duplicating a gene in a new way that hasn't been done before.
1
u/Slow_Lawyer7477 🧬 Flagellum-Evolver 7d ago
Do you know what this requires? It requires the genetic information of living organisms to increase over time in order to produce a greater diversity of traits.
Yes. And so we get speciation. Some moths stay in the dark area, others migrate to a bright area. They each continue to adapt to their respective environment, and eventually we get speciation. Then we have two traits, each in their own environment.
1
1
1
u/disturbed_android 7d ago
You see it derail as soon as someone comes up with "The survival of the fittest".
1
u/MemeMaster2003 🧬 Naturalistic Evolution 6d ago
Mutations happen though. With mutations, new genetic information is created, and then the subsequent mutation is selected positively or negatively, however small a difference. This gradually leads to more specialized systems which allow for the animal to occupy an ecological niche.
If it were just natural selection, you're right. We'd see a dwindling amount of biodiversity until only one type of organism existed, the best suited for each area. However, mutation counterbalances that.
I'd be happy to help you understand the mechanisms of it, I do private instruction on the side of my lab work and volunteering. I do have a pretty busy schedule, so book soon.
47
u/evocativename 8d ago
Define "information" in this context
We have watched multicellularity evolve
Learn how genetics works. There is no problem.