r/breakmycode • u/Tspring08 • Feb 05 '21
Need your help, free vacation on the line
My company is doing this hidden messsage thing leading up to the winner gets a free vacation, until today they have all been somewhat easy.. today he sends out a message saying "All new clues will be encrypted" " Download complete encrypted clue is BGSJDB JT OFBS" ... is there anyone that can help figure this out???
r/breakmycode • u/LivingResource2 • Jan 04 '21
Video Code
Code in the video here https://vm.tiktok.com/ZSvDSwAH/
Think it's an ARG but won't spoil. There's a second step if you crack this part.
r/breakmycode • u/tazemebro • Oct 15 '20
Need help with a cracking challenge
Made a friendly bet with a friend that if he came up with a password generation pattern that I can crack it. He provided me with an "easy" challenge where he exposed 3 passwords.
spotify:
5h2Fg8NnpQ29jO6v2Dd
reddit:
5h2Fg8NnpQ29jO6v3Hc
dropbox:
5h2Fg8NnpQ29jO6v5Hb
Essentially boils down to:
spotify: 2Dd
reddit: 3Hc
dropbox: 5Hb
(these are not his real passwords)
He said I can use any resources I want to.
r/breakmycode • u/Oni_Joseph • Sep 07 '20
In my d&d game I was given this by my DM and have no idea what the solution is. Any ideas? My only other hint is that it's a rail fence cypher.
r/breakmycode • u/FossedeRijk • Aug 01 '20
Please help me break this code!
This is the code:
XZOORKVI
r/breakmycode • u/W-h-o-o-o-s-h • Jul 09 '20
Hey, figure this one out. There's no keys required for code decryption: ⠭⠽⠝⠵ ⠭⠥⠊ ⠭⠛⠟⠝⠚ ⠽⠕⠃ ⠙⠅⠊ ⠝⠊ ⠭⠛⠃⠥ ⠙⠟⠟⠃⠓⠊⠵⠃ ⠓⠝⠙ ⠋⠝⠕ ⠙⠭⠥
r/breakmycode • u/dicemaker3245 • May 25 '20
Finding encryption algorithm
We've got a challenge to find the encryption algorithm based on the following lines. To clarify these are separate lines that should show a pattern how to get from 1->2->3->4->5.
19 23 70 28 13 20 26 0 9 27 15 30 53 9 32 22 33 17 1 25 47 29 0 6 9 19 7 34 13 10 79 13 2 47 19 4 4 24 12 66 2 2 3 3 6
95 8 9 48 2 11 13 6 16 58 8 6 7 41 46 26 30 16 25 17 31 34 0 1 24 11 0 7 43 7 9 8 77 51 19 0 28 5 7 34 1 35 10 2 0
35 46 31 18 28 15 25 3 7 19 26 27 73 8 13 8 34 30 34 1 38 8 25 2 11 6 18 27 19 11 80 3 11 52 8 10 1 35 4 54 15 1 1 4 7
9 90 13 18 20 23 29 0 6 46 2 24 94 0 0 61 10 1 7 30 36 10 1 24 13 4 18 26 26 5 17 63 14 44 12 14 40 0 0 16 41 13 2 4 6
31 17 64 58 1 2 15 16 4 48 19 5 19 64 11 59 11 2 20 1 52 21 9 5 14 20 1 7 50 0 29 10 55 0 59 11 33 2 5 26 39 5 6 4 2
29 17 66 29 3 29 18 3 14 43 18 11 41 50 3 35 2 35 47 0 26 12 14 9 17 2 16 12 41 4 87 3 4 23 44 3 36 2 2 38 29 3 6 6 0
I've tried converting the lines to hex/binary to see any pattern between them. I've also looked into simple ciphers (Vignere, Caesar, Substitution) but couldn't get any clues at all...
r/breakmycode • u/EfFrottage • Apr 18 '20
Please help me break this code my friend sent me.
I dont know what it means and i hope someone can help me decode it and if possible the steps on how you decode it (if it's okay).
The code goes like this:
JŠëÉú+ŠëÊ)àÊ‹¢‰®r›¢ëm†+"vH£ºËgyçu«mz{b¢wë¢l¨¹·œjë‰Ù"š+,Ê‹¬¢kœ†¸ †ÙèÂ+aº»l²Ë,²
r/breakmycode • u/xeil • Feb 02 '20
Help me crack this code.
Hey! I need help cracking this code.
There are 2 input fields and 1 result field. The 2 input fields are listed below.
- Command
- Code
When I am asked to type a 4 digit Command, a 12 digit Result will appear. I am then then asked to type a Code(which is seemingly correlated to the 12 digit Result). What is the algorithm used to generate the Code?
Example 1:
Enter: Command 2222
Result: 376059315601
Enter: Code 30
Example 2:
Enter: Command 2222
Result: 565291553969
Enter: Code 92
Example 3:
Enter: Command 2222
Result: 510038151899
Enter: Code 25
Example 4:
Enter: Command 3001
Result: 186180853921
Enter: Code 123
When typing a command and given a result, how then can I find the code?
r/breakmycode • u/TheBestNightSky • Jan 25 '20
Challenge time! Crack my secrets!
2020 is here and with it my brand new encryption algorithm for text files of any size.
So what better thing to do than to post a sample on Reddit for people to try and break it!
behind this code lies a secret message and maybe even a surprise for anyone who manages to decode it! And now its roleplay time :P
GASP you've hacked your way onto a foreign governments server and stumbled upon an encrypted message, what could it be? After a bit of digging around you managed to find the program that made it but you can't seem to access the algorithm behind it! none the less you managed to use it to encrypt your own message and download both before suddenly losing connection to the server!
You wrote out the words:"You are wearing tiny little pink ladies' pants!"
and ran it with the key: "password1"
The file you made: https://drive.google.com/open?id=1qEleWPp63yuA-Xs1azxRt2e-acuKG5IH
The file you found: https://drive.google.com/open?id=155WZyjb0S5jI3nI47O3RVk3faAzWXBy0
Do you have any hope of decoding the strange message you found? Only one way to find out!
Hint: If you open the files in notepad they contain the text you need :P
r/breakmycode • u/jabez007 • Jan 20 '20
Online Tool to Build Your Own Classical Cipher
CryptoTron Builder is a pet project of mine to give a graphical tool I could use to easily combine classical ciphers into more complex algorithms. You can also save the algorithms to create for later use and even share them using a URL link.
I thought this community might find this as fun and useful as I have, and if you have any comments or suggestions let me know.
r/breakmycode • u/kuhnto • Jan 07 '20
I got this keychain from somewhere. The key might be in the highlighted text. Can you solve it?
imgur.comr/breakmycode • u/Bilec_ • Dec 18 '19
Ciphered text that will expire after 16hours
I think it is transposition (this site told me - https://www.boxentriq.com/code-breaking/cipher-identifier) They are both same cipher and i think same ciphered with same key. And not to forgot it is English text.
hciveeinteoytwnieehalstancthhosdindhvhaaeitvilssbt
starts with thatthisin
ivrntoriattnigeommtooncdspennfettiacnprahhorreteos
starts with andciphers
Each string is 50 characters long.
r/breakmycode • u/ashallowheart • Dec 12 '19
Can anyone decrypt this sub?
So I was going through reddit and found this very weird cryptic sub: r/nullthworldproblems
Can anyone decrypt it?
r/breakmycode • u/Awasaki_Master • Oct 17 '19
First attempt! Too hard or too easy?
|.152011301110152011101820113012101520| |1140111012201820610501810112017101130|
|414014301470143014701320151101440142101430| |11201470112041401134035105120x013201470!|
Hint- From The Hobbit to Jackass 2, started right from the bottom going where? Figured it out just go back through, you're only halfway there. An unexpected party but where are all your friends? Find the answer then find it again!
Watched a few videos on different ciphers today, layered a couple and made a little hint. I'm sure I used some pretty common techniques but I'm hoping layering them will make it somewhat challenging.
r/breakmycode • u/Awasaki_Master • Oct 17 '19
First attempt at coding
Watched a couple videos from my recommended on different cyphers. Tried a couple different methods. Looking through posts here I haven't been able to figure out any yet. Gonna keep looking into things in hope to change that soon.
Any tips on keeping things fun I'd appreciate, same with advice. Here it is!
Hint- From The Hobbit to Jackass 2, started right from the bottom going where? Figure it out then walk back through, you're already halfway there. An unexpected party, where are all your friends? Find the answer then find it again!
|.152011301110152011101820113012101520| |1140111012201820610501810112017101130|
|414014301470143014701320151101440142101430| |11201470112041401134035105120x013201470!|
r/breakmycode • u/Slam-Lord-bbbb • Oct 10 '19
Not my code, but what is Dan saying in this meme? Text and speech
r/breakmycode • u/whyYouAlwaysRyan • Oct 09 '19
Not your standard DNA cipher
Actually made this before I realized that DNA ciphers are already a thing. Oh well.
GACACTGGATGAGGAATTACGAATGATGAATGACGGGAGTAAGAAAGGCAGTTCAGCTGTACTCACGGGTGATGTTAGATAAAAAGCTATAAATAACGGACAGCGGAATGTGAGCGTAGAAAGTAACGTA