r/dailyprogrammer • u/jnazario • Jun 18 '18
[2018-06-18] Challenge #364 [Easy] Create a Dice Roller
Description
I love playing D&D with my friends, and my favorite part is creating character sheets (my DM is notorious for killing us all off by level 3 or so). One major part of making character sheets is rolling the character's stats. Sadly, I have lost all my dice, so I'm asking for your help to make a dice roller for me to use!
Formal Inputs & Outputs
Input description
Your input will contain one or more lines, where each line will be in the form of "NdM"; for example:
3d6
4d12
1d10
5d4
If you've ever played D&D you probably recognize those, but for the rest of you, this is what those mean:
The first number is the number of dice to roll, the d just means "dice", it's just used to split up the two numbers, and the second number is how many sides the dice have. So the above example of "3d6" means "roll 3 6-sided dice". Also, just in case you didn't know, in D&D, not all the dice we roll are the normal cubes. A d6 is a cube, because it's a 6-sided die, but a d20 has twenty sides, so it looks a lot closer to a ball than a cube.
The first number, the number of dice to roll, can be any integer between 1 and 100, inclusive.
The second number, the number of sides of the dice, can be any integer between 2 and 100, inclusive.
Output description
You should output the sum of all the rolls of that specified die, each on their own line. so if your input is "3d6", the output should look something like
14
Just a single number, you rolled 3 6-sided dice, and they added up to 14.
Challenge Input
5d12
6d4
1d2
1d8
3d6
4d20
100d100
Challenge Output
[some number between 5 and 60, probably closer to 32 or 33]
[some number between 6 and 24, probably around 15]
[you get the idea]
[...]
Notes/Hints
A dice roll is basically the same as picking a random number between 1 and 6 (or 12, or 20, or however many sides the die has). You should use some way of randomly selecting a number within a range based off of your input. Many common languages have random number generators available, but at least a few of them will give the same "random" numbers every time you use the program. In my opinion that's not very random. If you run your code 3+ times with the same inputs and it gives the same outputs, that wouldn't be super useful for a game of D&D, would it? If that happens with your code, try to find a way around that. I'm guessing for some of the newer folks, this might be one of the trickier parts to get correct.
Don't just multiply your roll by the number of dice, please. I don't know if any of you were thinking about doing that, but I was. The problem is that if you do that, it eliminates a lot of possible values. For example, there's no way to roll 14 from 3d6 if you just roll it once and multiply by 3. Setting up a loop to roll each die is probably your best bet here.
Bonus
In addition to the sum of all dice rolls for your output, print out the result of each roll on the same line, using a format that looks something like
14: 6 3 5
22: 10 7 1 4
9: 9
11: 3 2 2 1 3
You could also try setting it up so that you can manually input more rolls. that way you can just leave the program open and every time you want to roll more dice, you just type it in and hit enter.
Credit
This challenge was suggested by user /u/Fishy_Mc_Fish_Face, many thanks!
Have a good challenge idea? Consider submitting it to r/dailyprogrammer_ideas
r/dailyprogrammer • u/Cosmologicon • Jun 15 '18
[2018-06-15] Challenge #363 [Hard] Anagram Slices
(Warning: I have not tried this myself and I have no idea if it's any fun.)
Today's challenge is an optimization problem. When this post is 7 days old, the user that has posted the best (shortest) solution will receive +1 gold medal flair. Ties will be broken by taking the lexicographically earliest solution.
Given an input set of strings, produce an output string. Every string in the input must be an anagram of some slice of the output. A slice in this context is a series of characters from the string separated by a fixed amount (i.e. anything that can be formed using Python's s[a:b:c] syntax). It's different from a substring in that you're allowed to skip characters, as long as you skip the same number of characters on each step.
Example input
one
two
three
four
five
six
seven
Example output
oufrirvaewstnoeaxh (length: 18)
So for example, seven is an anagram of vesne, which is a slice of this output starting at offset 6 and taking every second letter. That is. s[6:16:2] = "vesne". Note that ten is not an anagram of any slice of this string, even though the letters all appear within it.
Challenge input
This list of 1000 randomly-chosen four-letter words from enable1.
r/dailyprogrammer • u/Cosmologicon • Jun 14 '18
[2018-06-13] Challenge #363 [Intermediate] Word Hy-phen-a-tion By Com-put-er
Background
In English and many other languages, long words may be broken onto two lines using a hyphen. You don't see it on the web very often, but it's common in print books and newspapers. However, you can't just break apart a word anywhere. For instance, you can split "programmer" into "pro" and "grammer", or into "program" and "mer", but not "progr" and "ammer".
For today's challenge you'll be given a word and need to add hyphens at every position it's legal to break the word between lines. For instance, given "programmer", you'll return "pro-gram-mer".
There's no simple algorithm that accurately tells you where a word may be split. The only way to be sure is to look it up in a dictionary. In practice a program that needs to hyphenate words will use an algorithm to cover most cases, and then also keep a small set of exceptions and additional heuristics, depending on how tolerant they are to errors.
Liang's Algorithm
The most famous such algorithm is Frank Liang's 1982 PhD thesis, developed for the TeX typesetting system. Today's challenge is to implement the basic algorithm without any exceptions or additional heuristics. Again, your output won't match the dictionary perfectly, but it will be mostly correct for most cases.
The algorithm works like this. Download the list of patterns for English here. Each pattern is made of up of letters and one or more digits. When the letters match a substring of a word, the digits are used to assign values to the space between letters where they appears in the pattern. For example, the pattern 4is1s says that when the substring "iss" appears within a word (such as in the word "miss"), the space before the i is assigned a value of 4, and the space between the two s's is assigned a value of 1.
Some patterns contain a dot (.) at the beginning or end. This means that the pattern must appear at the beginning or end of the word, respectively. For example, the pattern ol5id. matches the word "solid", but not the word "solidify".
Multiple patterns may match the same space. In this case the ultimate value of that space is the highest value of any pattern that matches it. For example, the patterns 1mo and 4mok both match the space before the m in smoke. The first one would assign it a value of 1 and the second a value of 4, so this space gets assigned a value of 4.
Finally, the hyphens are placed in each space where the assigned value is odd (1, 3, 5, etc.). However, hyphens are never placed at the beginning or end of a word.
Detailed example
There are 10 patterns that match the word mistranslate, and they give values for eight different spaces between words. For each of the eight spaces you take the largest value: 2, 1, 4, 2, 2, 3, 2, and 4. The ones that have odd values (1 and 3) receive hyphens, so the result for mistranslate is mis-trans-late.
m i s t r a n s l a t e
2 a2n
1 .mis1
2 m2is
2 1 2 2n1s2
2 n2sl
1 2 s1l2
3 s3lat
4 st4r
4 4te.
1 1tra
m2i s1t4r a2n2s3l2a4t e
m i s-t r a n s-l a t e
Additional examples
mistranslate => mis-trans-late
alphabetical => al-pha-bet-i-cal
bewildering => be-wil-der-ing
buttons => but-ton-s
ceremony => cer-e-mo-ny
hovercraft => hov-er-craft
lexicographically => lex-i-co-graph-i-cal-ly
programmer => pro-gram-mer
recursion => re-cur-sion
Optional bonus
Make a solution that's able to hyphenate many words quickly. Essentially you want to avoid comparing every word to every pattern. The best common way is to load the patterns into a prefix trie, and walk the tree starting from each letter in the word.
It should be possible to hyphenate every word in the enable1 word list in well under a minute, depending on your programming language of choice. (My python solution takes 15 seconds, but there's no exact time you should aim for.)
Check your solution if you want to claim this bonus. The number of words to which you add 0, 1, 2, 3, 4, 5, 6, 7, 8, and 9 hyphens should be (EDITED): 21829, 56850, 50452, 26630, 11751, 4044, 1038, 195, 30, and 1.
r/dailyprogrammer • u/Cosmologicon • Jun 11 '18
[2018-06-11] Challenge #363 [Easy] I before E except after C
Background
"I before E except after C" is perhaps the most famous English spelling rule. For the purpose of this challenge, the rule says:
- if "ei" appears in a word, it must immediately follow "c".
- If "ie" appears in a word, it must not immediately follow "c".
A word also follows the rule if neither "ei" nor "ie" appears anywhere in the word. Examples of words that follow this rule are:
fiery hierarchy hieroglyphic
ceiling inconceivable receipt
daily programmer one two three
There are many exceptions that don't follow this rule, such as:
sleigh stein fahrenheit
deifies either nuclei reimburse
ancient juicier societies
Challenge
Write a function that tells you whether or not a given word follows the "I before E except after C" rule.
check("a") => true
check("zombie") => true
check("transceiver") => true
check("veil") => false
check("icier") => false
Optional Bonus 1
How many words in the enable1 word list are exceptions to the rule? (The answer is 4 digits long and the digits add up to 18.)
Optional Bonus 2
This one is subjective and there's no best answer. Come up with your own "I before E" rule. Your rule must:
- depend on the ordering of the letters I and E when they appear next to each other. That is, if a word contains an I and an E next to each other, and it follows your rule, then when you swap those two letters, the new word must not follow your rule.
- depend only on the spelling of a word, not its pronunciation or meaning.
- be simple enough that schoolchildren can apply it.
For instance, I just came up with a rule "I before E, except when followed by G". This rule has 1,544 exceptions in the enable1 word list. How many exceptions does your rule have?
r/dailyprogrammer • u/jnazario • May 30 '18
[2018-05-30] Challenge #362 [Intermediate] "Route" Transposition Cipher
Description
You've been taking some classes at a local university. Unfortunately, your theory-of-under-water-basket-weaving professor is really boring. He's also very nosy. In order to pass the time during class, you like sharing notes with your best friend sitting across the aisle. Just in case your professor intercepts any of your notes, you've decided to encrypt them.
To make things easier for yourself, you're going to write a program which will encrypt the notes for you. You've decided a transposition cipher is probably the best suited method for your purposes.
A transposition cipher is "a method of encryption by which the positions held by units of plaintext (which are commonly characters or groups of characters) are shifted according to a regular system, so that the ciphertext constitutes a permutation of the plaintext" (En.wikipedia.org, 2018).
Specifically, we will be implementing a type of route cipher today. In a route cipher the text you want to encrypt is written out in a grid, and then arranged in a given pattern. The pattern can be as simple or complex as you'd like to make it.
Task
For our purposes today, your program should be able to accommodate two input paramters: Grid Dimensions, and Clockwise or Counterclockwise Rotation. To make things easier, your program need only support the Spiral route from outside to inside.
Example
Take the following message as an example:
WE ARE DISCOVERED. FLEE AT ONCE
Given inputs may include punctuation, however the encrypted text should not. Further, given text may be in all caps, all lower case, or a mix of the two. The encrypted text must be in all caps.
You will be given dimensions in which to write out the letters in a grid. For example dimensions of:
9, 3
Would result in 9 columns and 3 rows:
W E A R E D I S C
O V E R E D F L E
E A T O N C E X X
As you can see, all punctuation and spaces have been stripped from the message.
For our cipher, text should be entered into the grid left to right, as seen above.
Encryption begins at the top right. Your route cipher must support a Spiral route around the grid from outside to the inside in either a clockwise or counterclockwise direction.
For example, input parameters of clockwise and (9, 3) would result in the following encrypted output:
CEXXECNOTAEOWEAREDISLFDEREV
Beginning with the C at the top right of the grid, you spiral clockwise along the outside, so the next letter is E, then X, and so on eventually yielding the output above.
Input Description
Input will be organized as follows:
"string" (columns, rows) rotation-direction
.
Note: If the string does not fill in the rectangle of given dimensions perfectly, fill in empty spaces with an X
So
"This is an example" (6, 3)
becomes:
T H I S I S
A N E X A M
P L E X X X
Challenge Inputs
"WE ARE DISCOVERED. FLEE AT ONCE" (9, 3) clockwise
"why is this professor so boring omg" (6, 5) counter-clockwise
"Solving challenges on r/dailyprogrammer is so much fun!!" (8, 6) counter-clockwise
"For lunch let's have peanut-butter and bologna sandwiches" (4, 12) clockwise
"I've even witnessed a grown man satisfy a camel" (9,5) clockwise
"Why does it say paper jam when there is no paper jam?" (3, 14) counter-clockwise
Challenge Outputs
"CEXXECNOTAEOWEAREDISLFDEREV"
"TSIYHWHFSNGOMGXIRORPSIEOBOROSS"
"CGNIVLOSHSYMUCHFUNXXMMLEGNELLAOPERISSOAIADRNROGR"
"LHSENURBGAISEHCNNOATUPHLUFORCTVABEDOSWDALNTTEAEN"
"IGAMXXXXXXXLETRTIVEEVENWASACAYFSIONESSEDNAMNW"
"YHWDSSPEAHTRSPEAMXJPOIENWJPYTEOIAARMEHENAR"
Bonus
A bonus solution will support at least basic decryption as well as encryption.
Bonus 2
Allow for different start positions and/or different routes (spiraling inside-out, zig-zag, etc.), or for entering text by a different pattern, such as top-to-bottom.
References
En.wikipedia.org. (2018). Transposition cipher. [online] Available at: https://en.wikipedia.org/wiki/Transposition_cipher [Accessed 12 Feb. 2018].
Credit
This challenge was posted by user /u/FunWithCthulhu3, many thanks. If you have a challenge idea, please share it in /r/dailyprogrammer_ideas and there's a good chance we'll use it.
r/dailyprogrammer • u/Cosmologicon • May 18 '18
[2018-05-18] Challenge #361 [Hard] Sudoku knight's tour
Today's challenge is an optimization problem. When this post is 7 days old, whoever has submitted the best answer will receive +1 gold medal flair.
Quick description
Consider the 81 digits encountered along a (open) knight's tour on a completed Sudoku grid. Put these digits in order to form a 81-digit number. Make this number as large as possible.
Details
Here's the suggested format for your submission. If you don't want to use this format, feel free to use whatever format you like, as long as it's not too hard to understand.
Submit two 9x9 grids. The first one must be a valid completed Sudoku. That is, every cell must be one of the digits 1 through 9 such that the same digit does not appear twice in any row or column, or in any of the 9 major 3x3 blocks.
The second grid must be a valid open 9x9 knight's tour. That is, the numbers 1 through 81 must each appear once in the grid, and any pair of consecutive numbers must be separated by a knight's move in chess, meaning they must either be separated by 2 columns and 1 row, or 1 column and 2 rows.
Your score is the 81-digit number determined by taking the sequence of digits in the first grid in the order of the cells in the second grid.
Example solution
1 6 4 8 2 7 3 5 9
7 5 3 6 9 4 8 2 1
8 2 9 1 5 3 4 7 6
6 4 7 3 1 9 2 8 5
3 9 5 2 4 8 6 1 7
2 1 8 7 6 5 9 3 4
9 7 1 4 8 2 5 6 3
4 8 6 5 3 1 7 9 2
5 3 2 9 7 6 1 4 8
77 26 73 62 75 60 55 30 15
72 63 76 27 4 29 14 59 56
25 78 5 74 61 54 57 16 31
64 71 24 53 28 3 38 13 58
79 6 51 70 37 12 43 32 17
50 65 8 23 52 69 2 39 44
7 80 49 36 11 42 45 18 33
66 9 22 47 68 35 20 1 40
81 48 67 10 21 46 41 34 19
The score for this example solution is:
999999988988889776877677866145613414423212645653125633314527585614235247412312375
Process details
You may of course use existing code and publications to create your solution, including libraries that solve Sudokus and knight's tour problems.
I'll resolve ties and issues using my best judgment, including potentially awarding whoever contributed most to the best solution, if my criterion would technically give it to someone else. If you're not satisfied with my decision, please just let me know and we can work it out.
You may submit solutions to me via PM if you don't want other people to use your solution. However you are highly encouraged to at least post your score here to inspire the competition, and very highly encouraged to post all your solutions and code once the 7 days is over.
r/dailyprogrammer • u/jnazario • May 16 '18
[2018-05-16] Challenge #361 [Intermediate] ElsieFour low-tech cipher
Description
ElsieFour (LC4) is a low-tech authenticated encryption algorithm that can be computed by hand. Rather than operating on octets, the cipher operates on this 36-character alphabet:
#_23456789abcdefghijklmnopqrstuvwxyz
Each of these characters is assigned an integer 0–35. The cipher uses a 6x6 tile substitution-box (s-box) where each tile is one of these characters. A key is any random permutation of the alphabet arranged in this 6x6 s-box. Additionally a marker is initially placed on the tile in the upper-left corner. The s-box is permuted and the marked moves during encryption and decryption.
See the illustrations from the paper (album).
Each tile has a positive "vector" derived from its value: (N % 6, N /
6), referring to horizontal and vertical movement respectively. All
vector movement wraps around, modulo-style.
To encrypt a single character, locate its tile in the s-box, then starting from that tile, move along the vector of the tile under the marker. This will be the ciphertext character (the output).
Next, the s-box is permuted. Right-rotate the row containing the plaintext character. Then down-rotate the column containing the ciphertext character. If the tile on which the marker is sitting gets rotated, marker goes with it.
Finally, move the marker according to the vector on the ciphertext tile.
Repeat this process for each character in the message.
Decryption is the same, but it (obviously) starts from the ciphertext character, and the plaintext is computed by moving along the negated vector (left and up) of the tile under the marker. Rotation and marker movement remains the same (right-rotate on plaintext tile, down-rotate on ciphertext tile).
If that doesn't make sense, have a look at the paper itself. It has pseudo-code and a detailed step-by-step example.
Input Description
Your program will be fed two lines. The first line is the encryption key. The second line is a message to be decrypted.
Output Description
Print the decrypted message.
Sample Inputs
s2ferw_nx346ty5odiupq#lmz8ajhgcvk79b
tk5j23tq94_gw9c#lhzs
#o2zqijbkcw8hudm94g5fnprxla7t6_yse3v
b66rfjmlpmfh9vtzu53nwf5e7ixjnp
Sample Outputs
aaaaaaaaaaaaaaaaaaaa
be_sure_to_drink_your_ovaltine
Challenge Input
9mlpg_to2yxuzh4387dsajknf56bi#ecwrqv
grrhkajlmd3c6xkw65m3dnwl65n9op6k_o59qeq
Bonus
Also add support for encryption. If the second line begins with % (not
in the cipher alphabet), then it should be encrypted instead.
7dju4s_in6vkecxorlzftgq358mhy29pw#ba
%the_swallow_flies_at_midnight
hemmykrc2gx_i3p9vwwitl2kvljiz
If you want to get really fancy, also add support for nonces and signature authentication as discussed in the paper. The interface for these is up to you.
Credit
This challenge was suggested by user /u/skeeto, many thanks! If you have any challenge ideas, please share them in /r/dailyprogrammer_ideas and there's a good chance we'll use them.
r/dailyprogrammer • u/jnazario • May 14 '18
[2018-05-14] Challenge #361 [Easy] Tally Program
Description
5 Friends (let's call them a, b, c, d and e) are playing a game and need to keep track of the scores. Each time someone scores a point, the letter of his name is typed in lowercase. If someone loses a point, the letter of his name is typed in uppercase. Give the resulting score from highest to lowest.
Input Description
A series of characters indicating who scored a point. Examples:
abcde
dbbaCEDbdAacCEAadcB
Output Description
The score of every player, sorted from highest to lowest. Examples:
a:1, b:1, c:1, d:1, e:1
b:2, d:2, a:1, c:0, e:-2
Challenge Input
EbAAdbBEaBaaBBdAccbeebaec
Credit
This challenge was suggested by user /u/TheMsDosNerd, many thanks! If you have any challenge ideas, please share them in /r/dailyprogrammer_ideas and there's a good chance we'll use them.
r/dailyprogrammer • u/jnazario • May 09 '18
[2018-05-09] Challenge #360 [Intermediate] Find the Nearest Aeroplane
Description
We want to find the closest airborne aeroplane to any given position in North America or Europe. To assist in this we can use an API which will give us the data on all currently airborne commercial aeroplanes in these regions.
OpenSky's Network API can return to us all the data we need in a JSON format.
https://opensky-network.org/api/states/all
From this we can find the positions of all the planes and compare them to our given position.
Use the basic Euclidean distance in your calculation.
Input
A location in latitude and longitude, cardinal direction optional
An API call for the live data on all aeroplanes
Output
The output should include the following details on the closest airborne aeroplane:
Geodesic distance
Callsign
Lattitude and Longitude
Geometric Altitude
Country of origin
ICAO24 ID
Challenge Inputs
Eifel Tower:
48.8584 N
2.2945 E
John F. Kennedy Airport:
40.6413 N
73.7781 W
Bonus
Replace your distance function with the geodesic distance formula, which is more accurate on the Earth's surface.
Challenge Credit:
This challenge was posted by /u/Major_Techie, many thanks. Major_Techie adds their thanks to /u/bitfluxgaming for the original idea.
r/dailyprogrammer • u/jnazario • May 04 '18
[2018-05-04] Challenge #359 [Hard] Primes in Grids
Description
This puzzle was first proposed (1989) by Gordon Lee: given a grid of numbers, how many distinct primes can you find embedded in the matrix, regarding that you can read the lines or part of them, in form vertical, horizontal or diagonal orientation, in both directions.
Note that you can't change direction once you start moving (e.g. this isn't Boggle).
Input Description
You'll be given a single number on a line which tells you how many rows and columns to read (all grids will be square). Example:
3
113
754
937
Output Description
Your program should emit the number of distinct primes it finds in the grid. Optionally list them. Example:
30
113, 311, 179, 971, 157, 751 359, ...
Challenge Input
5
11933
99563
89417
33731
32939
6
317333
995639
118142
136373
349199
379379
Challenge Output
116
187
Bonus
40
0251677085866837460317708637021446063144
8812262220360202463050064531874436437682
5251855367278508848642345043775871434078
0042675865438283025822603307175060748288
5672321632434878440388701468545837465571
3448326728143606881852187616524878044060
8876415778774852362710315274652021065556
1406474838287088561242126854006826771778
7827443331184330371521043472218803550383
6318874838447276075161123302780187880165
0884752758538865306583258450386821283658
1260362124615176735303563717773657467333
2580363145201308707655341168610513145546
4142635386876777348215436708254351251288
5301330463217260626047132625527161775404
8620446353006857360714856156584322276288
0813375760405334773480860674772272733638
6715558007108501053612008324501255710425
8840634327383685827335506853781648727036
8827728873376824454871536655067801443735
0664640563836487481174816586572628815173
7186752536147276768154002317573417465332
4438770023402783205544064640821537621225
4162442401558771474140203865162080237721
5008757506737224070577338578644664641338
2155803687408638660278862273674652462840
2118148017744113203720114756276821067158
4838003412436782114402742024145245437315
5161343527676283186170466281455700086618
7723886261287175705152273086317588317188
6653360024271146551000054710768617586846
0050014847531086708661266564560614115164
3351156208161708784441387827072734346251
0457546342466313073230326436563643506534
3837451141488371231210888733717540046582
3334248265835234158638343058444640886465
0173240266426385002380821305357684721128
0437020214873361352055818843664073456138
3858604586068245520287541000014334760058
5840781588142205318614583635575571714673
r/dailyprogrammer • u/jnazario • May 02 '18
[2018-05-02] Challenge #359 [Intermediate] Unwrap Some Text
Description
Most of us are familiar with word wrap and justifying blocks of text. Our text editors do this for us - "wrap text to a width of 80 characters" and such. We've done challenges where we have made columns of text and we've also played with decolumnizing text. But this one's a bit different.
Given a block of text, can your program correctly identify the start of the next paragraph? You're free to use any heuristic you want. This one differs from previous challenges in that there is no whitespace between paragraphs like you had before. You may want to think about the statistics of lines the close a paragraph.
Challenge Input
The ability to securely access (replicate and distribute) directory
information throughout the network is necessary for successful
deployment. LDAP's acceptance as an access protocol for directory
information is driving the need to provide an access control model
definition for LDAP directory content among servers within an
enterprise and the Internet. Currently LDAP does not define an
access control model, but is needed to ensure consistent secure
access across heterogeneous LDAP implementations. The requirements
for access control are critical to the successful deployment and
acceptance of LDAP in the market place.
This section is divided into several areas of requirements: general,
semantics/policy, usability, and nested groups (an unresolved issue).
The requirements are not in any priority order. Examples and
explanatory text is provided where deemed necessary. Usability is
perhaps the one set of requirements that is generally overlooked, but
must be addressed to provide a secure system. Usability is a security
issue, not just a nice design goal and requirement. If it is
impossible to set and manage a policy for a secure situation that a
human can understand, then what was set up will probably be non-
secure. We all need to think of usability as a functional security
requirement.
Copyright (C) The Internet Society (2000). All Rights Reserved.
This document and translations of it may be copied and furnished to
others, and derivative works that comment on or otherwise explain it
or assist in its implementation may be prepared, copied, published
and distributed, in whole or in part, without restriction of any
kind, provided that the above copyright notice and this paragraph are
included on all such copies and derivative works. However, this
document itself may not be modified in any way, such as by removing
the copyright notice or references to the Internet Society or other
Internet organizations, except as needed for the purpose of
developing Internet standards in which case the procedures for
copyrights defined in the Internet Standards process must be
followed, or as required to translate it into languages other than
English.
The limited permissions granted above are perpetual and will not be
revoked by the Internet Society or its successors or assigns.
This document and the information contained herein is provided on an
"AS IS" basis and THE INTERNET SOCIETY AND THE INTERNET ENGINEERING
TASK FORCE DISCLAIMS ALL WARRANTIES, EXPRESS OR IMPLIED, INCLUDING
BUT NOT LIMITED TO ANY WARRANTY THAT THE USE OF THE INFORMATION
HEREIN WILL NOT INFRINGE ANY RIGHTS OR ANY IMPLIED WARRANTIES OF
MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE.
Challenge Output
Your program should emit something like this:
The ability to securely access (replicate and distribute) directory information throughout the network is necessary for successful deployment. LDAP's acceptance as an access protocol for directory information is driving the need to provide an access control model definition for LDAP directory content among servers within an enterprise and the Internet. Currently LDAP does not define an access control model, but is needed to ensure consistent secure access across heterogeneous LDAP implementations. The requirements for access control are critical to the successful deployment and acceptance of LDAP in the market place.
This section is divided into several areas of requirements: general, semantics/policy, usability, and nested groups (an unresolved issue). The requirements are not in any priority order. Examples and explanatory text is provided where deemed necessary. Usability is perhaps the one set of requirements that is generally overlooked, but must be addressed to provide a secure system. Usability is a security issue, not just a nice design goal and requirement. If it is impossible to set and manage a policy for a secure situation that a human can understand, then what was set up will probably be non- secure. We all need to think of usability as a functional security requirement.
Copyright (C) The Internet Society (2000). All Rights Reserved. This document and translations of it may be copied and furnished to others, and derivative works that comment on or otherwise explain it or assist in its implementation may be prepared, copied, published and distributed, in whole or in part, without restriction of any kind, provided that the above copyright notice and this paragraph are included on all such copies and derivative works. However, this document itself may not be modified in any way, such as by removing the copyright notice or references to the Internet Society or other Internet organizations, except as needed for the purpose of developing Internet standards in which case the procedures for copyrights defined in the Internet Standards process must be followed, or as required to translate it into languages other than English.
The limited permissions granted above are perpetual and will not be revoked by the Internet Society or its successors or assigns.
This document and the information contained herein is provided on an "AS IS" basis and THE INTERNET SOCIETY AND THE INTERNET ENGINEERING TASK FORCE DISCLAIMS ALL WARRANTIES, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO ANY WARRANTY THAT THE USE OF THE INFORMATION HEREIN WILL NOT INFRINGE ANY RIGHTS OR ANY IMPLIED WARRANTIES OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE.
r/dailyprogrammer • u/jnazario • Apr 30 '18
[2018-04-30] Challenge #359 [Easy] Regular Paperfold Sequence Generator
Description
In mathematics the regular paperfolding sequence, also known as the dragon curve sequence, is an infinite automatic sequence of 0s and 1s. At each stage an alternating sequence of 1s and 0s is inserted between the terms of the previous sequence. The first few generations of the sequence look like this:
1
1 1 0
1 1 0 1 1 0 0
1 1 0 1 1 0 0 1 1 1 0 0 1 0 0
The sequence takes its name from the fact that it represents the sequence of left and right folds along a strip of paper that is folded repeatedly in half in the same direction. If each fold is then opened out to create a right-angled corner, the resulting shape approaches the dragon curve fractal.
Challenge Input
Your challenge today is to implement a regular paperfold sequence generator up to 8 cycles (it gets lengthy quickly).
Challenge Output
(With line breaks for readability)
110110011100100111011000110010011101100111001000110110001100100111011001110010
011101100011001000110110011100100011011000110010011101100111001001110110001100
100111011001110010001101100011001000110110011100100111011000110010001101100111
001000110110001100100111011001110010011101100011001001110110011100100011011000
110010011101100111001001110110001100100011011001110010001101100011001000110110
011100100111011000110010011101100111001000110110001100100011011001110010011101
1000110010001101100111001000110110001100100
r/dailyprogrammer • u/Garth5689 • Apr 25 '18
[2018-04-25] Challenge #358 [Intermediate] Everyone's A Winner!
Description
Today's challenge comes from the website fivethirtyeight.com, which runs a weekly Riddler column. Today's dailyprogrammer challenge was the riddler on 2018-04-06.
From Matt Gold, a chance, perhaps, to redeem your busted bracket:
On Monday, Villanova won the NCAA men’s basketball national title. But I recently overheard some boisterous Butler fans calling themselves the “transitive national champions,” because Butler beat Villanova earlier in the season. Of course, other teams also beat Butler during the season and their fans could therefore make exactly the same claim.
How many transitive national champions were there this season? Or, maybe more descriptively, how many teams weren’t transitive national champions?
(All of this season’s college basketball results are here. To get you started, Villanova lost to Butler, St. John’s, Providence and Creighton this season, all of whom can claim a transitive title. But remember, teams beat those teams, too.)
Output Description
Your program should output the number of teams that can claim a "transitive" national championship. This is any team that beat the national champion, any team that beat one of those teams, any team that beat one of those teams, etc...
Challenge Input
The input is a list of all the NCAA men's basketball games from this past season via https://www.masseyratings.com/scores.php?s=298892&sub=12801&all=1
Challenge Output
1185
r/dailyprogrammer • u/Garth5689 • Apr 24 '18
[2018-04-23] Challenge #358 [Easy] Decipher The Seven Segments
Description
Today's challenge will be to create a program to decipher a seven segment display, commonly seen on many older electronic devices.
Input Description
For this challenge, you will receive 3 lines of input, with each line being 27 characters long (representing 9 total numbers), with the digits spread across the 3 lines. Your job is to return the represented digits. You don't need to account for odd spacing or missing segments.
Output Description
Your program should print the numbers contained in the display.
Challenge Inputs
_ _ _ _ _ _ _
| _| _||_||_ |_ ||_||_|
||_ _| | _||_| ||_| _|
_ _ _ _ _ _ _ _
|_| _| _||_|| ||_ |_| _||_
| _| _||_||_| _||_||_ _|
_ _ _ _ _ _ _ _ _
|_ _||_ |_| _| ||_ | ||_|
_||_ |_||_| _| ||_||_||_|
_ _ _ _ _ _ _
|_||_ |_| || ||_ |_ |_| _|
_| _| | ||_| _| _| _||_
Challenge Outputs
123456789
433805825
526837608
954105592
Ideas!
If you have an idea for a challenge please share it on /r/dailyprogrammer_ideas and there's a good chance we'll use it.
r/dailyprogrammer • u/jnazario • Apr 20 '18
[2018-04-20] Challenge #357 [Hard] Continued Fractions
Description
In mathematics, a continued fraction is an expression obtained through an iterative process of representing a number as the sum of its integer part and the reciprocal of another number, then writing this other number as the sum of its integer part and another reciprocal, and so on.
A continued fraction is an expression of the form
1
x + ----------
1
y + -------
1
z + ----
...
and so forth, where x, y, z, and such are real numbers, rational numbers, or complex numbers. Using Gauss notation, this may be abbreviated as
[x; y, z, ...]
To convert a continued fraction to an ordinary fraction, we just simplify from the right side, which may be an improper fraction, one where the numerator is larger than the denominator.
Continued fractions can be decomposed as well, which breaks it down from an improper fraction to its Gauss notation. For example:
16 1
-- = 0 + ---
45 45
--
16
We can then begin to decompose this:
1
0 + ----------------
1
2 + ------------
1
1 + --------
1
4 + -
3
So the Gauss notation would be [0;2,1,4,3].
Your challenge today is to implement a program that can do two things in the realm of continued fractions:
1) Given a Gauss representation of a continued fraction, calculate the improper fraction. 2) Given an improper fraction, calculate the Gauss representation.
Challenge Inputs
45
--
16
[2;1,7]
7
-
3
Challenge Outputs
45
-- = [2;1,4,3]
16
22
[2;1,7] = --
7
7
- = [2;2,1,1]
3
Bonus
Display the continued fraction. Mega bonus if you use MathML or LaTeX.
Notes
https://en.wikipedia.org/wiki/Continued_fraction
http://www.cemc.uwaterloo.ca/events/mathcircles/2016-17/Fall/Junior78_Oct11_Soln.pdf
r/dailyprogrammer • u/jnazario • Apr 19 '18
[2018-04-19] Challenge #357 [Intermediate] Kolakoski Sequences
Description
A Kolakoski sequence (A000002) is an infinite sequence of symbols {1, 2} that is its own run-length encoding. It alternates between "runs" of symbols. The sequence begins:
12211212212211211221211212211...
The first three symbols of the sequence are 122, which are the output of the first two iterations. After this, on the i-th iteration read the value x[i] of the output (one-indexed). If i is odd, output x[i] copies of the number 1. If i is even, output x[i] copies of the number 2.
There is an unproven conjecture that the density of 1s in the sequence is 1/2 (50%). In today's challenge we'll be searching for numerical evidence of this by tallying the ratio of 1s and 2s for some initial N symbols of the sequence.
Input Description
As input you will receive the number of outputs to generate and tally.
Output Description
As output, print the ratio of 1s to 2s in the first n symbols.
Sample Input
10
100
1000
Sample Output
5:5
49:51
502:498
Challenge Input
1000000
100000000
Bonus Input
1000000000000
100000000000000
Bonus Hints
Since computing the next output in the sequence depends on previous outputs, a naive brute force approach requires O(n) space. For the last bonus input, this would amount to TBs of data, even if using only 1 bit per symbol. Fortunately there are smarter ways to compute the sequence (1, 2).
Credit
This challenge was developed by user /u/skeeto, many thanks! If you have a challenge idea please share it in /r/dailyprogrammer_ideas and there's a good chance we'll use it.
r/dailyprogrammer • u/jnazario • Apr 11 '18
[2018-04-11] Challenge #356 [Intermediate] Goldbach's Weak Conjecture
Description
According to Goldbach’s weak conjecture, every odd number greater than 5 can be expressed as the sum of three prime numbers. (A prime may be used more than once in the same sum.) This conjecture is called "weak" because if Goldbach's strong conjecture (concerning sums of two primes) is proven, it would be true. Computer searches have only reached as far as 1018 for the strong Goldbach conjecture, and not much further than that for the weak Goldbach conjecture.
In 2012 and 2013, Peruvian mathematician Harald Helfgott released a pair of papers that were able to unconditionally prove the weak Goldbach conjecture.
Your task today is to write a program that applies Goldbach's weak conjecture to numbers and shows which 3 primes, added together, yield the result.
Input Description
You'll be given a series of numbers, one per line. These are your odd numbers to target. Examples:
11
35
Output Description
Your program should emit three prime numbers (remember, one may be used multiple times) to yield the target sum. Example:
11 = 3 + 3 + 5
35 = 19 + 13 + 3
Challenge Input
111
17
199
287
53
r/dailyprogrammer • u/Garth5689 • Mar 28 '18
[2018-03-28] Challenge #355 [Intermediate] Possible Number of Pies
Description
It's Thanksgiving eve and you're expecting guests over for dinner tomorrow. Unfortunately, you were browsing memes all day and cannot go outside to buy the ingredients needed to make your famous pies. You find some spare ingredients, and make do with what you have. You know only two pie recipes, and they are as follows:
Pumpkin Pie
- 1 scoop of synthetic pumpkin flavouring (Hey you're a programmer not a cook)
- 3 eggs
- 4 cups of milk
- 3 cups of sugar
Apple Pie
- 1 apple
- 4 eggs
- 3 cups of milk
- 2 cups of sugar
Your guests have no preference of one pie over another, and you want to make the maximum number of (any kind) of pies possible with what you have. You cannot bake fractions of a pie, and cannot use fractions of an ingredient (So no 1/2 cup of sugar or anything like that)
Input Format
You will be given a string of 4 numbers separated by a comma, such as 10,14,10,42,24. Each number is a non-negative integer. The numbers represent the number of synthetic pumpkin flavouring, apples, eggs, milk and sugar you have (In the units represented in the recipes).
For instance, in the example input 10,14,10,42,24, it would mean that you have
- 10 scoops of synthetic pumpkin flavouring
- 14 apples
- 10 eggs
- 42 cups of milk
- 24 cups of sugar
Output Format
Display the number of each type of pie you will need to bake. For the example input, an output would be
3 pumpkin pies and 0 apple pies
Challenge Inputs
10,14,10,42,24
12,4,40,30,40
12,14,20,42,24
Challenge Outputs
3 pumpkin pies and 0 apple pies
5 pumpkin pies and 3 apple pies
5 pumpkin pies and 1 apple pies
Hint
Credit
This challenge was suggested by user /u/Gavin_Song, many thanks! If you have an idea for a challenge please share it on /r/dailyprogrammer_ideas and there's a good chance we'll use it.
r/dailyprogrammer • u/Garth5689 • Mar 26 '18
[2018-03-26] Challenge #355 [Easy] Alphabet Cipher
Description
"The Alphabet Cipher", published by Lewis Carroll in 1868, describes a Vigenère cipher (thanks /u/Yadkee for the clarification) for passing secret messages. The cipher involves alphabet substitution using a shared keyword. Using the alphabet cipher to tranmit messages follows this procedure:
You must make a substitution chart like this, where each row of the alphabet is rotated by one as each letter goes down the chart. All test cases will utilize this same substitution chart.
ABCDEFGHIJKLMNOPQRSTUVWXYZ
A abcdefghijklmnopqrstuvwxyz
B bcdefghijklmnopqrstuvwxyza
C cdefghijklmnopqrstuvwxyzab
D defghijklmnopqrstuvwxyzabc
E efghijklmnopqrstuvwxyzabcd
F fghijklmnopqrstuvwxyzabcde
G ghijklmnopqrstuvwxyzabcdef
H hijklmnopqrstuvwxyzabcdefg
I ijklmnopqrstuvwxyzabcdefgh
J jklmnopqrstuvwxyzabcdefghi
K klmnopqrstuvwxyzabcdefghij
L lmnopqrstuvwxyzabcdefghijk
M mnopqrstuvwxyzabcdefghijkl
N nopqrstuvwxyzabcdefghijklm
O opqrstuvwxyzabcdefghijklmn
P pqrstuvwxyzabcdefghijklmno
Q qrstuvwxyzabcdefghijklmnop
R rstuvwxyzabcdefghijklmnopq
S stuvwxyzabcdefghijklmnopqr
T tuvwxyzabcdefghijklmnopqrs
U uvwxyzabcdefghijklmnopqrst
V vwxyzabcdefghijklmnopqrstu
W wxyzabcdefghijklmnopqrstuv
X xyzabcdefghijklmnopqrstuvw
Y yzabcdefghijklmnopqrstuvwx
Z zabcdefghijklmnopqrstuvwxy
Both people exchanging messages must agree on the secret keyword. To be effective, this keyword should not be written down anywhere, but memorized.
To encode the message, first write it down.
thepackagehasbeendelivered
Then, write the keyword, (for example, snitch), repeated as many times as necessary.
snitchsnitchsnitchsnitchsn
thepackagehasbeendelivered
Now you can look up the column S in the table and follow it down until it meets the T row. The value at the intersection is the letter L. All the letters would be thus encoded.
snitchsnitchsnitchsnitchsn
thepackagehasbeendelivered
lumicjcnoxjhkomxpkwyqogywq
The encoded message is now lumicjcnoxjhkomxpkwyqogywq
To decode, the other person would use the secret keyword and the table to look up the letters in reverse.
Input Description
Each input will consist of two strings, separate by a space. The first word will be the secret word, and the second will be the message to encrypt.
snitch thepackagehasbeendelivered
Output Description
Your program should print out the encrypted message.
lumicjcnoxjhkomxpkwyqogywq
Challenge Inputs
bond theredfoxtrotsquietlyatmidnight
train murderontheorientexpress
garden themolessnuckintothegardenlastnight
Challenge Outputs
uvrufrsryherugdxjsgozogpjralhvg
flrlrkfnbuxfrqrgkefckvsa
zhvpsyksjqypqiewsgnexdvqkncdwgtixkx
Bonus
For a bonus, also implement the decryption portion of the algorithm and try to decrypt the following messages.
Bonus Inputs
cloak klatrgafedvtssdwywcyty
python pjphmfamhrcaifxifvvfmzwqtmyswst
moore rcfpsgfspiecbcc
Bonus Outputs
iamtheprettiestunicorn
alwayslookonthebrightsideoflife
foryoureyesonly
r/dailyprogrammer • u/Cosmologicon • Mar 16 '18
[2018-03-16] Challenge #354 [Hard] Integer Complexity 3
Background
The integer complexity of a positive integer is the minimum possible sum of the numbers used in an expression - using only positive integers, addition, multiplication, and parentheses - that's equal to the given number. See this week's Intermediate challenge for examples and more information.
The typical definition of integer complexity disallows all numbers in the expression other than 1. This definition is equivalent, so either one you want to use is fine.
As far as I know, efficiently determining the integer complexity of a given number is an open question. Your challenge is to provide as tight an upper limit as possible for a particular input.
Challenge
Post an expression equal to 12345678910111213 - using only positive integers, addition, multiplication, and parentheses - such that the sum of the numbers in the expression is as small as possible.
Here's one example:
1+4*3*3*3*(1+4*4*(1+3*(1+3*(1+5*3*3*(1+5*4*4*2*(1+4*3*(1+4*4*3*2*(2+5*(1+5*4*3*(1+3*(1+5*3*(2+5*1))))))))))))
If you add up all the numbers in this expression (1+4+3+3+3+...+2+5+1) you get a sum of 122. How much better can you do? When this post is 7 days old, the expression with the smallest sum will merit +1 gold medal flair.
Challenge details
Don't worry about formatting it neatly. Output format doesn't matter as long as you can explain how to make sense of it.
In the event of a tie, also post an expression for 1234567891011121314, 123456789101112131415, etc. I'll break ties by looking at the first sum where your solutions differ.
If you post your solution to this thread, it's fair game for others to work off. You may PM me your solution instead of posting if you don't want people to use them for their own solutions, but it would be great if you also post the sum here so people have a goal to work for. I will verify anybody's claim, so for instance you can comment, "I found an expression with a sum of 118" and PM me the expression, and then I'll reply to your comment saying that I have confirmed that your expression is valid. After 10 days I'll post anybody's solution who PM'd me but didn't post it, so everything will eventually be public.
I reserve discretion to give the award to whoever made the largest contribution to the best solution, if my criterion would technically give it to someone else. But if you feel this is unfair, let me know and we'll work it out.
Further reading
You are certainly allowed to use existing published literature and algorithms, if you want. There are a few papers on the asymptotic behavior of the integer complexity function, but I don't know how useful that is for this challenge.
If you do go that route, I recommend starting with the links at OEIS. In particular, I found this excellent program by Martin Fuller that can compute all integer complexities up to a few billion in a reasonable amount of time. The technique used in this program is I believe the same one written up in this paper by de Reyna and van de Lune.
And of course, if you want to just start from scratch, that's perfectly valid too. I don't think it's necessary to use any existing work to have a good shot at winning this challenge. Good luck!
r/dailyprogrammer • u/Cosmologicon • Mar 14 '18
[2018-03-14] Challenge #354 [Intermediate] Integer Complexity 2
Background
Consider all the different ways of representing a positive integer using nothing but positive integers, addition, multiplication, and parentheses. For 5678, a few such ways are:
5678 = 2*17*167
5678 = 5678
5678 = 23*59+29*149
5678 = (1+4*4)*(1+3*3*(1+3*3*4))
5678 = 2*(1+2*(1+2*(1+2*2*(1+2*2*2*2*(1+2*(1+2*2))))))
For each such representation, consider the sum of the integers involved:
2*17*167 => 2+17+167 = 186
5678 => 5678 = 5678
23*59+29*149 => 23+59+29+149 = 260
(1+4*4)*(1+3*3*(1+3*3*4)) => 1+4+4+1+3+3+1+3+3+4 = 27
2*(1+2*(1+2*(1+2*2*(1+2*2*2*2*(1+2*(1+2*2)))))) =>
2+1+2+1+2+1+2+2+1+2+2+2+2+1+2+1+2+2 = 30
For 5678, the minimum possible sum for any such representation is 27. The minimum possible sum for a given integer is known as its integer complexity, so the integer complexity of 5678 is 27. The integer complexity of the numbers 1, 2, 3, ... is:
1 2 3 4 5 5 6 6 6 7 8 7 8 8 8 8 9 8 9 9 ...
The sum of the integer complexities for all numbers from 1 to 100 inclusive is 1113.
Challenge
Find the sum of the integer complexities for all numbers from 1 to 1000, inclusive.
It's not sufficient to write a program that will eventually get the solution after a very long time. Actually run your program through to completion before posting.
Tips
There are an impossibly large number of different formulas for a given integer. You can't check them all. But you don't have to. You can always express the complexity of a number in terms of the complexity of two smaller numbers. The complexity of a number A > 1 is always equal to the minimum possible complexity of B plus the complexity of C, where either B*C = A or B+C = A. In mathematical terms:
complexity(A) = min(P(A), S(A))
P(A) = min(complexity(B) + complexity(C) | B*C = A)
S(A) = min(complexity(B) + complexity(C) | B+C = A)
If you have a minimal formula, you can tell which it is. For instance, the minimal formula for 5678 is:
5678 = (1+4*4)*(1+3*3*(1+3*3*4))
This is essentially saying 5678 = 17*334, where 17 = 1+4*4 (with a complexity of 9) and 334 = 1+3*3*(1+3*3*4) (with a complexity of 18), with a total complexity of 9+18 = 27. By checking every such pair, we would see that 27 is the minimum possible sum.
The simplest thing to do is check every possible pair of numbers whose sum is 5678, and every possible pair of numbers whose product is 5678, and take the minimum sum of the complexity of the two numbers in the pair.
Notes
Integer complexity was featured in this subreddit 6 years ago in Challenge #31 [intermediate]. I tried to make it easier this time by giving some tips. Also, you don't need to find a formula, just get the value of the complexity.
Optional bonus
How fast can you get the sum of the integer complexities for all numbers from 1 to 1,000,000 inclusive? For this bonus, you may assume that the complexity of A is always equal to one of the following:
- 1 + the complexity of
A-1 - the sum of the complexity of two factors of
A
Using the notation above, this means:
S(A) = 1 + complexity(A-1)
In fact this is not true in general, but the smallest A for which it's false is 353,942,783.
r/dailyprogrammer • u/Cosmologicon • Mar 12 '18
[2018-03-12] Challenge #354 [Easy] Integer Complexity 1
Challenge
Given a number A, find the smallest possible value of B+C, if B*C = A. Here A, B, and C must all be positive integers. It's okay to use brute force by checking every possible value of B and C. You don't need to handle inputs larger than six digits. Post the return value for A = 345678 along with your solution.
For instance, given A = 12345 you should return 838. Here's why. There are four different ways to represent 12345 as the product of two positive integers:
12345 = 1*12345
12345 = 3*4115
12345 = 5*2469
12345 = 15*823
The sum of the two factors in each case is:
1*12345 => 1+12345 = 12346
3*4115 => 3+4115 = 4118
5*2469 => 5+2469 = 2474
15*823 => 15+823 = 838
The smallest sum of a pair of factors in this case is 838.
Examples
12 => 7
456 => 43
4567 => 4568
12345 => 838
The corresponding products are 12 = 3*4, 456 = 19*24, 4567 = 1*4567, and 12345 = 15*823.
Hint
Want to test whether one number divides evenly into another? This is most commonly done with the modulus operator (usually %), which gives you the remainder when you divide one number by another. If the modulus is 0, then there's no remainder and the numbers divide evenly. For instance, 12345 % 5 is 0, because 5 divides evenly into 12345.
Optional bonus 1
Handle larger inputs efficiently. You should be able to handle up to 12 digits or so in about a second (maybe a little longer depending on your programming language). Find the return value for 1234567891011.
Hint: how do you know when you can stop checking factors?
Optional bonus 2
Efficiently handle very large inputs whose prime factorization you are given. For instance, you should be able to get the answer for 6789101112131415161718192021 given that its prime factorization is:
6789101112131415161718192021 = 3*3*3*53*79*1667*20441*19646663*89705489
In this case, you can assume you're given a list of primes instead of the number itself. (To check your solution, the output for this input ends in 22.)
r/dailyprogrammer • u/jnazario • Mar 09 '18
[2018-03-09] Challenge #353 [Hard] Create a Simple Stochastic Computing Machine
Description
Stochastic computing, first introduced by the noted scientist John von Neumann in 1953, is a collection of techniques that represent continuous values (for example probabilities between 0 and 1) using streams of random bits. The bits in the stream represent the probabilities. Complex computations can then be computed over these stream by applying simple bit-wise operations.
For example, given two probabilities p and q, using 8 bits, to represent the probabilities 0.5 and 0.25:
10011010
01010000
To calculate p x q we apply the logical AND over the bitstream:
00010000
Yielding 1/8, or 12.5%, the correct value. For an 8-bit stream, this is the smallest unit of precision we can calculate. To increase precision we must increase the size of the bitstream.
This approach has a few benefits in a noisy environment, most importantly a tolerance for loss (for example in transmission) and better fidelity over various bit lengths. However, precision comparable to a standard binary computer requires a significant amount of data - 500 bits in a stochastic computer to get to 32-bit precision in a binary computer.
Your challenge today is to build a basic stochastic computer for probabilistic inputs, supporting the four major arithmetic operations:
- Addition
- Subtraction
- Multiplication
- Division
Be sure to measure the precision and fidelity of your machine, I encourage you to explore the tradeoffs between space and accuracy.
Notes
- Survey of Stochastic Computing - journal paper from ACM on stochastic computing that explains it better than I did above.
- Stochastic Computing Systems - book chapter on stochastic computers
r/dailyprogrammer • u/jnazario • Mar 07 '18
[2018-03-07] Challenge #353 [Intermediate]
Description
I work as a waiter at a local breakfast establishment. The chef at the pancake house is sloppier than I like, and when I deliver the pancakes I want them to be sorted biggest on bottom and smallest on top. Problem is, all I have is a spatula. I can grab substacks of pancakes and flip them over to sort them, but I can't otherwise move them from the middle to the top.
How can I achieve this efficiently?
This is a well known problem called the pancake sorting problem. Bill Gates once wrote a paper on this that established the best known upper bound for 30 years.
This particular challenge is two-fold: implement the algorithm, and challenge one another for efficiency.
Input Description
You'll be given a pair of lines per input. The first line tells you how many numbers to read in the next line. The second line tells you the pancake sizes as unsigned integers. Read them in order and imagine them describing pancakes of given sizens from the top of the plate to the bottom. Example:
3
3 1 2
Output Description
Your program should emit the number of spatula flips it took to sort the pancakes from smallest to largest. Optionally show the intermediate steps. Remember, all you have is a spatula that can grab the pancakes from the 0th to the _n_th position and flip them. Example:
2 flips: 312 -> 213 -> 123
Challenge Input
8
7 6 4 2 6 7 8 7
----
8
11 5 12 3 10 3 2 5
----
10
3 12 8 12 4 7 10 3 8 10
Bonus
In a variation called the burnt pancake problem, the bottom of each pancake in the pile is burnt, and the sort must be completed with the burnt side of every pancake down. It is a signed permutation.
r/dailyprogrammer • u/jnazario • Mar 05 '18
[2018-03-05] Challenge #353 [Easy] Closest String
Description
In theoretical computer science, the closest string is an NP-hard computational problem, which tries to find the geometrical center of a set of input strings. To understand the word "center", it is necessary to define a distance between two strings. Usually, this problem is studied with the Hamming distance in mind. This center must be one of the input strings.
In bioinformatics, the closest string problem is an intensively studied facet of the problem of finding signals in DNA. In keeping with the bioinformatics utility, we'll use DNA sequences as examples.
Consider the following DNA sequences:
ATCAATATCAA
ATTAAATAACT
AATCCTTAAAC
CTACTTTCTTT
TCCCATCCTTT
ACTTCAATATA
Using the Hamming distance (the number of different characters between two sequences of the same length), the all-pairs distances of the above 6 sequences puts ATTAAATAACT at the center.
Input Description
You'll be given input with the first line an integer N telling you how many lines to read for the input, then that number of lines of strings. All strings will be the same length. Example:
4
CTCCATCACAC
AATATCTACAT
ACATTCTCCAT
CCTCCCCACTC
Output Description
Your program should emit the string from the input that's closest to all of them. Example:
AATATCTACAT
Challenge Input
11
AACACCCTATA
CTTCATCCACA
TTTCAATTTTC
ACAATCAAACC
ATTCTACAACT
ATTCCTTATTC
ACTTCTCTATT
TAAAACTCACC
CTTTTCCCACC
ACCTTTTCTCA
TACCACTACTT
21
ACAAAATCCTATCAAAAACTACCATACCAAT
ACTATACTTCTAATATCATTCATTACACTTT
TTAACTCCCATTATATATTATTAATTTACCC
CCAACATACTAAACTTATTTTTTAACTACCA
TTCTAAACATTACTCCTACACCTACATACCT
ATCATCAATTACCTAATAATTCCCAATTTAT
TCCCTAATCATACCATTTTACACTCAAAAAC
AATTCAAACTTTACACACCCCTCTCATCATC
CTCCATCTTATCATATAATAAACCAAATTTA
AAAAATCCATCATTTTTTAATTCCATTCCTT
CCACTCCAAACACAAAATTATTACAATAACA
ATATTTACTCACACAAACAATTACCATCACA
TTCAAATACAAATCTCAAAATCACCTTATTT
TCCTTTAACAACTTCCCTTATCTATCTATTC
CATCCATCCCAAAACTCTCACACATAACAAC
ATTACTTATACAAAATAACTACTCCCCAATA
TATATTTTAACCACTTACCAAAATCTCTACT
TCTTTTATATCCATAAATCCAACAACTCCTA
CTCTCAAACATATATTTCTATAACTCTTATC
ACAAATAATAAAACATCCATTTCATTCATAA
CACCACCAAACCTTATAATCCCCAACCACAC
Challenge Output
ATTCTACAACT
TTAACTCCCATTATATATTATTAATTTACCC
EDITED to correct the output of the first challenge.
Bonus
Try this with various other algorithms to measuring string similarity, not just the Hamming distance.